Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples
This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).
Data and resources
-
HTML Open
-
Download the dataset.HTML Open
-
Public information for AAS project AAS4556HTML Open
-
Citation reference for this metadata record and dataset.HTML Open
-
PNG Open
Additional information
| Temporal extent | 2019-11-16 – 2019-11-26 |
|---|---|
| Date (publication) | 2023-01-20 |
| Status | completed |
| Update frequency | asNeeded |
| Metadata language | en |
| License | This metadata record is publicly available. |
| Source metadata | ISO 19115 XML |
| Last updated | 2026-11-05 |
| Created | 2026-11-05 |
| API | package_show |